update syntax to call subroutines (faccfe25) · Commits · github_fork / Universc

launch_universc.sh

+18 −18

Original line number	Diff line number	Diff line
		@@ -2724,12 +2724,12 @@ else

		echo " ...concatencate barcodes to R1 from I1 and I2 index files"
		# concatenate barcocdes from index to R1 as (bases 1-16 of the) barcode, moving (read to start at base 17-)
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additive=${convI1} --additive=${convI2} --ref_fastq=${convR1} --out_dir $crIN
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additives ${convI1} --additives ${convI2} --ref_fastq ${convR1} --out_dir $crIN
		else
		barcodelength=$indexlength
		echo " ...concatencate barcodes to R1 from I1 index files"
		# concatenate barcocdes from index to R1 as (bases 1-6 of the) barcode, moving (read to start at base 7-)
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additive=${convI1} --ref_fastq=${convR1} --out_dir $crIN
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additives ${convI1} --ref_fastq ${convR1} --out_dir $crIN
		fi

		#returns a combined R1 file with I1-R1 concatenated (I1 is cell barcode)
		@@ -2740,7 +2740,7 @@ else
		echo "adding mock UMI"
		fi
		# add mock UMI (count reads instead of UMI) barcodelength=6, umi_default=10
		perl ${TOOLS}/AddMockUMI.pl --fastq=${convR1} --out_dir $crIN --head_length=$barcodelength --umi_length=$umi_default
		perl ${TOOLS}/AddMockUMI.pl --fastq ${convR1} --out_dir $crIN --head_length $barcodelength --umi_length $umi_default
		umilength=$umi_default
		umiadjust=0
		if [[ $chemistry == "SC3Pv3" ]]; then
		@@ -2799,7 +2799,7 @@ else
		# filter UMI reads by matching tag sequence ATTGCGCAATG (bases 1-11 of R1) and remove as an adapters

		#same as SmartSeq2
		perl ${TOOLS}/FilterSmartSeqReadUMI.pl --r1=${convR1} --r2=${convR2} --tag="AAGCAGTGGTATCAACGCAGAGTAC" --out_dir $crIN
		perl ${TOOLS}/FilterSmartSeqReadUMI.pl --r1 ${convR1} --r2 ${convR2} --tag "AAGCAGTGGTATCAACGCAGAGTAC" --out_dir $crIN
		echo " ...trim tag sequence from R1"

		# returns R1 with tag sequence removed (left trim) starting with 8pbp UMI and corresponding reads for I1, I2, and R2
		@@ -2831,7 +2831,7 @@ else
		echo "adding mock UMI"
		fi
		# add mock UMI (count reads instead of UMI) barcodelength=10 or 11, umi_default=10 <- default for "icell8-5-prime" and "icell8-full-length"
		perl ${TOOLS}/AddMockUMI.pl --fastq=${convR1} --out_dir $crIN --head_length=$barcodelength --umi_length=$umi_default
		perl ${TOOLS}/AddMockUMI.pl --fastq ${convR1} --out_dir $crIN --head_length $barcodelength --umi_length $umi_default
		umilength=$umi_default
		umiadjust=0
		if [[ $chemistry == "SC3Pv3" ]]; then
		@@ -2934,7 +2934,7 @@ else
		echo " ...concatencate barcodes to R1 from I1 index file"
		# concatenate barcocdes from dual indexes to R1 as (bases 1-8 of the) barcode (bases 1-16), moving UMI to (17-22)
		# filter UMI reads by matching tag sequence ATTGCGCAATG (bases 1-11 of R1) and remove as an adapters
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additive=${convI1} --ref_fastq=${convR1} --out_dir $crIN
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additives ${convI1} --ref_fastq ${convR1} --out_dir $crIN

		#returns a combined R1 file with I1-I2-R1 concatenated (I1 and I2 are R1 barcode)
		mv $crIN/Concatenated_File.fastq ${convR1}
		@@ -3015,7 +3015,7 @@ else
		echo " ...concatencate barcodes to R1 from I1 and I2 index files"
		# concatenate barcocdes from dual indexes to R1 as (bases 1-20 of the) barcode, moving RT barcode (21-30) UMI to (31-38)
		# filter UMI reads by matching tag sequence ATTGCGCAATG (bases 1-11 of R1) and remove as an adapters
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additive=${convI1} --additive=${convI2} --ref_fastq=${convR1} --out_dir $crIN
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additives ${convI1} --additives ${convI2} --ref_fastq ${convR1} --out_dir $crIN

		#returns a combined R1 file with I1-I2-R1 concatenated (I1 and I2 are R1 barcode)
		mv $crIN/Concatenated_File.fastq ${convR1}
		@@ -3067,7 +3067,7 @@ else
		echo " ...concatencate barcodes to R1 from I1 and I2 index files"
		# concatenate barcocdes from dual indexes to R1 as (bases 1-20 of the) barcode, moving RT barcode (21-30) UMI to (31-38)
		# filter UMI reads by matching tag sequence ATTGCGCAATG (bases 1-11 of R1) and remove as an adapters
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additive=${convI1} --additive=${convI2} --ref_fastq=${convR1} --out_dir $crIN
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additives ${convI1} --additives ${convI2} --ref_fastq ${convR1} --out_dir $crIN

		#returns a combined R1 file with I1-I2-R1 concatenated (I1 and I2 are R1 barcode)
		mv $crIN/Concatenated_File.fastq ${convR1}
		@@ -3107,7 +3107,7 @@ else
		echo " ...concatencate 10x ATAC barcodes to R1 from I2 index files"
		# concatenate barcocdes from dual indexes to R1 as (bases 1-16 of the 27 bp) barcode, moving RT barcode (17-27) UMI to (28-35)
		# filter UMI reads by matching tag sequence ATTGCGCAATG (bases 1-11 of R1) and remove as an adapters
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additive=${convI2} --ref_fastq=${convR1} --out_dir $crIN
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additives ${convI2} --ref_fastq ${convR1} --out_dir $crIN

		#returns a combined R1 file with I1-I2-R1 concatenated (I1 and I2 are R1 barcode)
		mv $crIN/Concatenated_File.fastq ${convR1}
		@@ -3129,7 +3129,7 @@ else
		if [[ "$technology" == "strt-seq" ]]; then
		# add mock UMI (count reads instead of UMI) barcodelength=6, umi_default=10
		echo " ...generate mock UMI for compatibility"
		perl ${TOOLS}/AddMockUMI.pl --fastq=${convR1} --out_dir $crIN --head_length=$barcodelength --umi_length=$umi_default
		perl ${TOOLS}/AddMockUMI.pl --fastq ${convR1} --out_dir $crIN --head_length $barcodelength --umi_length $umi_default
		umilength=$umi_default
		umiadjust=0
		chemistry="SC5P-PE"
		@@ -3143,7 +3143,7 @@ else
		chemistry="SC5P-R1"
		echo " ...concatencate barcodes to R1 from I1 index files"
		# concatenate barcocdes from I1 index to R1 as barcode (bases 1-8)
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additive=${convI1} --ref_fastq=${convR1} --out_dir $crIN
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additives ${convI1} --ref_fastq ${convR1} --out_dir $crIN
		fi
		if [[ "$technology" == "strt-seq-2i" ]]; then
		convI1=$(echo $read \| perl -pne 's/(.*)_R1/$1_I1/' )
		@@ -3151,7 +3151,7 @@ else
		chemistry="SC5P-R1"
		echo " ...concatencate barcodes to R1 from I1 and I2index files"
		# concatenate barcocdes from I1 index to R1 as barcode (bases 1-8)
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additive=${convI1} --additive=${convI2} --ref_fastq=${convR1} --out_dir $crIN
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additives ${convI1} --additives ${convI2} --ref_fastq ${convR1} --out_dir $crIN
		fi

		#convert TSO to expected length for 10x 5' (TSS in R1 from base 39)
		@@ -3274,7 +3274,7 @@ else
		echo " ...remove internal reads for ${technology} by matching TSO sequence for UMI reads"
		# filter UMI reads by matching tag sequence ATTGCGCAATG (bases 1-11 of R1) and remove as an adapters

		perl ${TOOLS}/FilterSmartSeqReadUMI.pl --r1=${convR1} --r2=${convR2} --i1=${convI1} --i2=${convI2} --tag="AAGCAGTGGTATCAACGCAGAGTAC" --out_dir $crIN
		perl ${TOOLS}/FilterSmartSeqReadUMI.pl --r1 ${convR1} --r2 ${convR2} --i1 ${convI1} --i2 ${convI2} --tag "AAGCAGTGGTATCAACGCAGAGTAC" --out_dir $crIN
		echo " ...trim tag sequence from R1"

		# returns R1 with tag sequence removed (left trim) starting with 8pbp UMI and corresponding reads for I1, I2, and R2
		@@ -3285,14 +3285,14 @@ else

		echo " ...concatencate barcodes to R1 from I1 and I2 index files"
		# concatenate barcocdes from dual indexes to R1 as barcode (bases 1-16)
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additive=${convI1} --additive=${convI2} --ref_fastq=${convR1} --out_dir $crIN
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additives ${convI1} --additives ${convI2} --ref_fastq ${convR1} --out_dir $crIN

		#returns a combined R1 file with I1-I2-R1 concatenated (I1 and I2 are R1 barcode)
		## 16 bp barcode, GGG for TSO, no UMI
		mv $crIN/Concatenated_File.fastq ${convR1}

		# add mock UMI (count reads instead of UMI) barcodelength=16, umi_default=10
		perl ${TOOLS}/AddMockUMI.pl --fastq=${convR1} --out_dir $crIN --head_length=$barcodelength --umi_length=$umi_default
		perl ${TOOLS}/AddMockUMI.pl --fastq ${convR1} --out_dir $crIN --head_length $barcodelength --umi_length $umi_default
		umilength=$umi_default
		umiadjust=0
		chemistry="SC3Pv2"
		@@ -3340,7 +3340,7 @@ else

		echo " ...remove internal for ${technology} by matching tag sequence for UMI reads"
		# filter UMI reads by matching tag sequence ATTGCGCAATG (bases 1-11 of R1) and remove as an adapters
		perl ${TOOLS}/FilterSmartSeqReadUMI.pl --r1=${convR1} --r2=${convR2} --i1=${convI1} --i2=${convI2} --tag="ATTGCGCAATG" --out_dir=$crIN
		perl ${TOOLS}/FilterSmartSeqReadUMI.pl --r1 ${convR1} --r2 ${convR2} --i1 ${convI1} --i2 ${convI2} --tag "ATTGCGCAATG" --out_dir $crIN
		echo " ...trim tag sequence from R1"

		# returns R1 with tag sequence removed (left trim) starting with 8pbp UMI and corresponding reads for I1, I2, and R2
		@@ -3351,7 +3351,7 @@ else

		echo " ...concatencate barcodes to R1 from I1 and I2 index files"
		# concatenate barcocdes from dual indexes to R1 as barcode (bases 1-16)
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additive=${convI1} --additive=${convI2} --ref_fastq=${convR1} --out_dir=$crIN
		perl ${TOOLS}/ConcatenateDualIndexBarcodes.pl --additives ${convI1} --additives ${convI2} --ref_fastq ${convR1} --out_dir $crIN

		#returns a combined R1 file with I1-I2-R1 concatenated (I1 and I2 are R1 barcode)
		mv $crIN/Concatenated_File.fastq ${convR1}
		@@ -3428,7 +3428,7 @@ else
		if [[ $chemistry == "SC3Pv3" ]]; then
		chemistry="SC3Pv2"
		fi
		perl ${TOOLS}/AddMockUMI.pl --fastq=${convR1} --out_dir $crIN --head_length=$barcodelength --umi_length=$umi_default
		perl ${TOOLS}/AddMockUMI.pl --fastq ${convR1} --out_dir $crIN --head_length $barcodelength --umi_length $umi_default
		umilength=$umi_default
		umiadjust=0
		if [[ $chemistry == "SC3Pv3" ]]; then

Admin message