update subroutines for ICELL8 5' scRNA and Full length Smart-Seq ICELL8 cx (e0bfbf62) · Commits · github_fork / Universc

launch_universc.sh

+23 −18

Original line number	Diff line number	Diff line
		@@ -2725,6 +2725,8 @@ else
		#returns a combined R1 file with barcode and mock UMI
		## 6 bp barcode, 10 bp UMI (TSO not handled yet)
		mv $crIN/mock_UMI.fastq ${convR1}
		#avoids mock UMI being generated twice
		nonUMI=false
		fi

		if [[ "$technology" == "c1-cage" ]]; then
		@@ -2755,7 +2757,7 @@ else
		fi

		#ICELL8 version 2 (non-UMI technology)
		if [[ "$technology" == "icell8" ]] && [[ $nonUMI ]]; then
		if [[ "$technology" == "icell8" ]] \|\| [[ "$technology" == "icell8-5-prime" ]] \|\| [[ "$technology" == "icell8-full-length" ]]; then
		echo " ...processsing for ${technology}"
		if [[ $verbose ]]; then
		echo "Note: ICELL8 v2 does not contain UMIs"
		@@ -2766,10 +2768,12 @@ else
		convR2=$(echo $read \| perl -pne 's/(.*)_R1/$1_R2/' )

		if [[ $chemistry == "SC5P"* ]] \|\| [[ $chemistry == "five"* ]]; then
		if [[ "$technology" == "icell8-full-length" ]]; then
		## echo " ...remove internal reads for ${technology} by matching TSO sequence for UMI reads"
		# filter UMI reads by matching tag sequence ATTGCGCAATG (bases 1-11 of R1) and remove as an adapters

		perl sub/FilterSmartSeqReadUMI.pl --r1=${convR1} --r2=${convR2} --tag="AAAAAAAAAAAAAAAAAAAA" --out_dir $crIN
		#same as SmartSeq2
		perl sub/FilterSmartSeqReadUMI.pl --r1=${convR1} --r2=${convR2} --tag="AAGCAGTGGTATCAACGCAGAGTAC" --out_dir $crIN
		echo " ...trim tag sequence from R1"

		# returns R1 with tag sequence removed (left trim) starting with 8pbp UMI and corresponding reads for I1, I2, and R2
		@@ -2777,7 +2781,7 @@ else
		mv $crIN/parsed_R2.fastq ${convR2}
		mv $crIN/parsed_I1.fastq ${convI1}
		mv $crIN/parsed_I2.fastq ${convI2}

		fi
		fi

		if [[ $nonUMI ]]; then
		@@ -2804,6 +2808,7 @@ else
		mv $crIN/mock_UMI.fastq ${convR1}
		fi

		#subroutine for icell8-5-prime (5' scRNA with TSO adapters) or icell8-full-length (assumes barcodes and mock UMI added above)
		if [[ $chemistry == "SC5P"* ]] \|\| [[ $chemistry == "five"* ]]; then
		#remove TSO adapters (from ends)
		sed -E '
		@@ -2875,20 +2880,20 @@ else
		echo " handling $convFile ..."
		tsoS="TTTCTTATATGGG" #<- confirm tag sequence with Takara reps
		tsoQ="IIIIIIIIIIIII"
		#Add 10x TSO characters to the end of the sequence
		cmd=$(echo 'sed -E "2~4s/(.{'$barcodelength'})(.{'${umilength}'})(.{3})/\1\2'$tsoS'/" '$convFile' > '${crIN}'/.temp') #<- confirm tag sequence (GGG) with Takara reps
		#Add 10x TSO characters to the end of the sequence (remove 'CCGGG' linker)
		cmd=$(echo 'sed -E "2~4s/(.{'$barcodelength'})(.{'${umilength}'})(.{5})/\1\2'$tsoS'/" '$convFile' > '${crIN}'/.temp') #<- confirm tag sequence (GGG) with Takara reps
		if [[ $verbose ]]; then
		echo technology $technology
		echo barcode: $barcodelength
		echo umi: $umilength
		echo $cmd
		fi
		# run command with barcode and umi length, e.g.,: sed -E "2~4s/(.{16})(.{8})(.{3})(.*)/\1\2$tsoS\4/" $convFile > ${crIN}/.temp
		# run command with barcode and umi length, e.g.,: sed -E "2~4s/(.{10})(.{8})(.{5})(.*)/\1\2$tsoS\4/" $convFile > ${crIN}/.temp
		eval $cmd
		mv ${crIN}/.temp $convFile
		#Add n characters to the end of the quality
		cmd=$(echo 'sed -E "4~4s/(.{'$barcodelength'})(.{'${umilength}'})(.{3})/\1\2'$tsoQ'/" '$convFile' > '${crIN}'/.temp')
		# run command with barcode and umi length, e.g.,: sed -E "4~4s/(.{16})(.{8})(.{3})(.*)/\1\2$tsoQ\4/" $convFile > ${crIN}/.temp
		cmd=$(echo 'sed -E "4~4s/(.{'$barcodelength'})(.{'${umilength}'})(.{5})/\1\2'$tsoQ'/" '$convFile' > '${crIN}'/.temp')
		# run command with barcode and umi length, e.g.,: sed -E "4~4s/(.{10})(.{8})(.{5})(.*)/\1\2$tsoQ\4/" $convFile > ${crIN}/.temp
		eval $cmd
		mv ${crIN}/.temp $convFile
		fi

Admin message