Commit ade99d33 authored by TomKellyGenetics's avatar TomKellyGenetics
Browse files

update parameters for separate Smart-Seq2 and Smart-Seq3 presets

parent 307df2be

README.Rmd

+4 −2
Original line number Diff line number Diff line
@@ -177,7 +177,8 @@ default settings, see the [installation](#Uninstalling) or [troubleshooting](#De 
-  Quartz-Seq2 (15bp barcode, 8bp UMI): quartzseq2-1536

-  SCRB-Seq (6bp barcode, 10bp UMI): scrbseq, mcscrbseq

-  SeqWell (12bp barcode, 8bp UMI): seqwell

-  Smart-seq2-UMI, Smart-seq3 (16bp barcode, 8bp UMI): smartseq

-  Smart-seq, Smart-seq2 (16bp barcode, No UMI): smartseq2

-  Smart-seq2-UMI, Smart-seq3 (16bp barcode, 8bp UMI): smartseq3



All technologies support 3' single-cell RNA-Seq. Barcode adjustments and

whitelists are changed automatically. For 5' single-cell RNA-Seq, this
@@ -1002,7 +1003,8 @@ Mandatory arguments to long options are mandatory for short options too. 
                                  Quartz-Seq2 (14bp barcode, 8bp UMI): quartzseq2-384

                                  Quartz-Seq2 (15bp barcode, 8bp UMI): quartzseq2-1536

                                  SCRB-Seq (6bp barcode, 10bp UMI): scrbseq, mcscrbseq

                                  Smart-seq2-UMI, Smart-seq3 (16bp barcode, 8bp UMI): smartseq

                                  Smart-seq, Smart-seq2 (16bp barcode, No UMI): smartseq2

                                  Smart-seq2-UMI, Smart-seq3 (16bp barcode, 8bp UMI): smartseq3

                                  SeqWell (12bp barcode, 8bp UMI): seqwell

                                  SureCell (18bp barcode, 8bp UMI): surecell, ddseq, biorad

                                Custom inputs are also supported by giving the name "custom" and length of barcode and UMI separated by "_"

README.html

+4 −2
Original line number Diff line number Diff line
@@ -62,7 +62,8 @@ 
<li>Quartz-Seq2 (15bp barcode, 8bp UMI): quartzseq2-1536</li>

<li>SCRB-Seq (6bp barcode, 10bp UMI): scrbseq, mcscrbseq</li>

<li>SeqWell (12bp barcode, 8bp UMI): seqwell</li>

<li>Smart-seq2-UMI, Smart-seq3 (16bp barcode, 8bp UMI): smartseq</li>

<li>Smart-seq, Smart-seq2 (16bp barcode, No UMI): smartseq2</li>

<li>Smart-seq2-UMI, Smart-seq3 (16bp barcode, 8bp UMI): smartseq3</li>

</ul>

<p>All technologies support 3' single-cell RNA-Seq. Barcode adjustments and whitelists are changed automatically. For 5' single-cell RNA-Seq, this is only supported for 10x Genomics version 2 chemistry. This is detected automatically but can be configured with the <code>--chemistry</code> argument.</p>

<p>We are developing technologies to support dual indexes and full length scRNA kits.</p>
@@ -477,7 +478,8 @@ Mandatory arguments to long options are mandatory for short options too. 
                                  Quartz-Seq2 (14bp barcode, 8bp UMI): quartzseq2-384

                                  Quartz-Seq2 (15bp barcode, 8bp UMI): quartzseq2-1536

                                  SCRB-Seq (6bp barcode, 10bp UMI): scrbseq, mcscrbseq

                                  Smart-seq2-UMI, Smart-seq3 (16bp barcode, 8bp UMI): smartseq

                                  Smart-seq, Smart-seq2 (16bp barcode, No UMI): smartseq2

                                  Smart-seq2-UMI, Smart-seq3 (16bp barcode, 8bp UMI): smartseq3

                                  SeqWell (12bp barcode, 8bp UMI): seqwell

                                  SureCell (18bp barcode, 8bp UMI): surecell, ddseq, biorad

                                Custom inputs are also supported by giving the name &quot;custom&quot; and length of barcode and UMI separated by &quot;_&quot;

README.md

+5 −3
Original line number Diff line number Diff line
@@ -6,7 +6,7 @@ affiliations: 
   index: 1

 - name: "RIKEN Center for Sustainable Resource Sciences, Suehiro-cho-1-7-22, Tsurumi Ward, Yokohama, Kanagawa 230-0045, Japan"

   index: 2

date: "Saturday 06 February 2021"

date: "Wednesday 17 February 2021"

output:

  prettydoc::html_pretty:

       theme: cayman
@@ -177,7 +177,8 @@ default settings, see the [installation](#Uninstalling) or [troubleshooting](#De 
-  Quartz-Seq2 (15bp barcode, 8bp UMI): quartzseq2-1536

-  SCRB-Seq (6bp barcode, 10bp UMI): scrbseq, mcscrbseq

-  SeqWell (12bp barcode, 8bp UMI): seqwell

-  Smart-seq2-UMI, Smart-seq3 (16bp barcode, 8bp UMI): smartseq

-  Smart-seq, Smart-seq2 (16bp barcode, No UMI): smartseq2

-  Smart-seq2-UMI, Smart-seq3 (16bp barcode, 8bp UMI): smartseq3



All technologies support 3' single-cell RNA-Seq. Barcode adjustments and

whitelists are changed automatically. For 5' single-cell RNA-Seq, this
@@ -1002,7 +1003,8 @@ Mandatory arguments to long options are mandatory for short options too. 
                                  Quartz-Seq2 (14bp barcode, 8bp UMI): quartzseq2-384

                                  Quartz-Seq2 (15bp barcode, 8bp UMI): quartzseq2-1536

                                  SCRB-Seq (6bp barcode, 10bp UMI): scrbseq, mcscrbseq

                                  Smart-seq2-UMI, Smart-seq3 (16bp barcode, 8bp UMI): smartseq

                                  Smart-seq, Smart-seq2 (16bp barcode, No UMI): smartseq2

                                  Smart-seq2-UMI, Smart-seq3 (16bp barcode, 8bp UMI): smartseq3

                                  SeqWell (12bp barcode, 8bp UMI): seqwell

                                  SureCell (18bp barcode, 8bp UMI): surecell, ddseq, biorad

                                Custom inputs are also supported by giving the name "custom" and length of barcode and UMI separated by "_"

launch_universc.sh

+17 −6
Original line number Diff line number Diff line
@@ -209,7 +209,8 @@ Mandatory arguments to long options are mandatory for short options too. 
                                  Quartz-Seq2 (15bp barcode, 8bp UMI): quartzseq2-1536

                                  SCRB-Seq (6bp barcode, 10bp UMI): scrbseq, mcscrbseq

                                  SeqWell (12bp barcode, 8bp UMI): seqwell

                                  Smart-seq2-UMI, Smart-seq3 (16bp barcode, 8bp UMI): smartseq

                                  Smart-seq, Smart-seq2 (16bp barcode, No UMI): smartseq2

                                  Smart-seq2-UMI, Smart-seq3 (16bp barcode, 8bp UMI): smartseq3

                                  SPLiT-Seq (10bp UMI, 18bp barcode): splitseq

                                  SureCell (18bp barcode, 8bp UMI): surecell, ddseq, biorad

                                Custom inputs are also supported by giving the name "custom" and length of barcode and UMI separated by "_"
@@ -618,7 +619,9 @@ elif [[ "$technology" == "scrbseq" ]] || [[ "$technology" == "scrb-seq" ]] || [[ 
    technology="scrbseq"

elif [[ "$technology" == "seqwell" ]] || [[ "$technology" == "seq-well" ]]; then

    technology="seqwell"

elif [[ "$technology" == "smartseq" ]] || [[ "$technology" == "smart-seq" ]] || [[ "$technology" == "smartseq2" ]] || [[ "$technology" == "smart-seq2" ]] ||  [[ "$technology" == "smartseq2-umi" ]] || [[ "$technology" == "smart-seq2-umi" ]] ||  [[ "$technology" == "smartseq3" ]] || [[ "$technology" == "smart-seq3" ]]; then

elif [[ "$technology" == "smartseq" ]] || [[ "$technology" == "smart-seq" ]] || [[ "$technology" == "smartseq2" ]] || [[ "$technology" == "smart-seq2" ]]

    technology="smartseq2"

elif [[ "$technology" == "smartseq2-umi" ]] || [[ "$technology" == "smart-seq2-umi" ]] ||  [[ "$technology" == "smartseq3" ]] || [[ "$technology" == "smart-seq3" ]]; then

    technology="smartseq"

elif [[ "$technology" == "splitseq" ]] || [[ "$technology" == "split-seq" ]]; then

    technology="splitseq"
@@ -649,12 +652,12 @@ fi 
if [[ "$technology" == "icell8" ]]; then

    echo "***WARNING: ${technology} should only be used for kits that have valid UMIs***"

fi

if [[ "$technology" == "smartseq" ]]; then

if [[ "$technology" == "smartseq" ]] || [[ "$technology" == "smartseq2-umi" ]] || [[ "$technology" == "smartseq3" ]]; then

    echo "***WARNING: ${technology} should only be used for kits that have UMIs***"

    echo "... UMI reads will be filtered using a tag sequence which will be removed"

    echo "... barcodes will derived from dual indexes"

fi

if [[ "$technology" == "smartseq" ]] || [[ "$technology" == "indrop-v1" ]] || [[ "$technology" == "indrop-v2" ]] || [[ "$technology" == "indrop-v3" ]]; then

if [[ "$technology" == "smartseq2" ]] || [[ "$technology" == "smartseq3" ]] || [[ "$technology" == "indrop-v1" ]] || [[ "$technology" == "indrop-v2" ]] || [[ "$technology" == "indrop-v3" ]]; then

    echo "***Note: launch_universc.sh support for barcodes in dual indexes is experimental. Make sure that samples are demultiplexed prior to running launch_universc.sh***"

fi

##########
@@ -737,7 +740,11 @@ elif [[ "$technology" == "seqwell" ]]; then 
    barcodelength=8

    umilength=12

    minlength=8

elif [[ "$technology" == "smartseq" ]]; then

elif [[ "$technology" == "smartseq2" ]]; then

    barcodelength=16

    umilength=8

    minlength=16

elif [[ "$technology" == "smartseq3" ]]; then

    barcodelength=16

    umilength=8

    minlength=16
@@ -1488,7 +1495,7 @@ else 
            barcodefile=${whitelistdir}/inDrop-v3_barcodes.txt

            echo "***WARNING: ***combination of list1 and list2 from indrop-v2 (https://github.com/indrops/indrops/issues/32)***"  

        fi

    elif [[ "$technology" == "smartseq" ]]; then

    elif [[ "$technology" == "smartseq3" ]]; then

        barcodefile=${whitelistdir}/SmartSeq3_barcode.txt 

    else

        echo "***WARNING: whitelist for ${technology} will be all possible combinations of ${minlength}bp. valid barcode will be 100% as a result***"
@@ -2375,6 +2382,10 @@ else 
            mv $crIN/Concatenated_File.fastq ${convR1}

        done

    fi

    #Smart-Seq2

    #echo 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'

    #echo 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'



    #converting barcodes

    echo " adjusting barcodes of R1 files"

    if [[ $barcodeadjust != 0 ]]; then

man/launch_universc.sh

+2 −1
Original line number Diff line number Diff line
@@ -199,7 +199,8 @@ Provides a conversion script to run multiple technologies and custom libraries w 
                                  Quartz-Seq2 (15bp barcode, 8bp UMI): quartzseq2-1536

                                  SCRB-Seq (6bp barcode, 10bp UMI): scrbseq, mcscrbseq

                                  SeqWell (12bp barcode, 8bp UMI): seqwell

                                  Smart-seq2-UMI, Smart-seq3 (16bp barcode, 8bp UMI): smartseq

                                  Smart-seq, Smart-seq2 (16bp barcode, No UMI): smartseq2

                                  Smart-seq2-UMI, Smart-seq3 (16bp barcode, 8bp UMI): smartseq3

                                  SPLiT-Seq (10bp UMI, 18bp barcode): splitseq

                                  SureCell (18bp barcode, 8bp UMI): surecell, ddseq, biorad

                                Custom inputs are also supported by giving the name "custom" and length of barcode and UMI separated by "_"

CRA Git | Maintained and supported by SUSTech CRA and CCSE