corrected the log output for TrimSeq4scRNAseq.pl to properly output index... (6aadc510) · Commits · github_fork / Universc

sub/TrimSeq4scRNAseq.pl

+2 −2

Original line number	Diff line number	Diff line
		@@ -74,6 +74,7 @@ if (!$index) {
		if (!$out) {
		die "USAGE: option --out is required.\n";
		}
		my @indices = @{ $index };

		#checking option quality
		if (-e $out && -d $out) {
		@@ -98,7 +99,7 @@ open (LOG, ">", "$log") or die "cannot open $log.\n";
		print LOG "#####TrimSeq4scRNAseq.pl LOG#####\n";
		print LOG "R1 file:\t$r1\n";
		print LOG "R2 file:\t$r2\n";
		print LOG "Index sequence:\t$index\n";
		print LOG "Index sequence:\t@indices\n";
		print LOG "\n";
		print LOG "Tool versions:\n";
		print LOG "\tFASTQC $fastqc_version\n";
		@@ -197,7 +198,6 @@ print TRIMMINGS "$univ_adapter\n";
		print TRIMMINGS ">IlluminaUniversalAdapter_rc\n";
		print TRIMMINGS "$univ_adapter_rc\n";

		my @indices = @{ $index };
		foreach my $ind (@indices) {
		my $nextera_pcr_primer_i7 = "CAAGCAGAAGACGGCATACGAGAT".$ind."GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG";
		my $nextera_pcr_primer_i7_rc = reverse $nextera_pcr_primer_i7;