update documentation for 1.2.2 (03d38c00) · Commits · github_fork / Universc

launch_universc.sh

+4 −3

Original line number	Diff line number	Diff line
		@@ -249,7 +249,7 @@ Mandatory arguments to long options are mandatory for short options too.
		5′ scRNA-Seq ('SC5P-PE') is available only for 10x Genomics, ICELL8, SmartSeq, and STRT-Seq technologies.
		Setting 'SC3Pv1' for 10x version 1 chemistry is recommended.
		All other technologies default to 3′ scRNA-Seq parameters. Only 10x Genomics, ICELL8, and SmartSeq2 allow choosing which to use.
		For SmartSeq2 this parameter detemines using full-length sequences or 5' ends with internal reads removed.
		For SmartSeq2 this parameter detemines using full-length sequences or 5′ ends with internal reads removed.

		-n, --force-cells NUM Force pipeline to use this number of cells, bypassing the cell detection algorithm.
		-j, --jobmode MODE Job manager to use. Valid options: 'local' (default), 'sge', 'lsf', or a .template file
		@@ -2201,7 +2201,7 @@ fi


		#####checking if jobmode matches expected input#####
		if [[ "$jobmode" != "local" ]] && [[ "$jobmode" != "sge" ]] && [[ "$jobmode" != "lsf" ]] && [[ "$jobmode" != *"template" ]]; then
		if [[ "$jobmode" != "local" ]] && [[ "$jobmode" != "sge" ]] && [[ "$jobmode" != "lsf" ]] && [[ "$jobmode" != "slurm" ]] && [[ "$jobmode" != *"template" ]]; then
		echo "Error: option --jobmode must be local, sge, lsf, or a .template file"
		exit 1
		fi
		@@ -3454,7 +3454,8 @@ else
		mv $crIN/parsed_R2.fastq ${convR2}
		mv $crIN/parsed_I1.fastq ${convI1}
		mv $crIN/parsed_I2.fastq ${convI2}
		elif [[ ${chemistry} == "SC3Pv2" ]] \|\| [[ ${chemistry} == "SC5P-PE" ]];
		else
		#if [[ ${chemistry} == "SC3Pv2" ]] \|\| [[ ${chemistry} == "SC5P-PE" ]];
		# remove tag sequence adapter (first occurence only)
		sed -E '
		/^AAGCAGTGGTATCAACGCAGAGTACGG/ {

podman_build.sh

+4 −4

Original line number	Diff line number	Diff line
		@@ -11,10 +11,10 @@ git push tag $version
		echo "building Docker container version $version"
		podman build -t universc:$version .
		podman tag universc:$version universc:latest
		podman tag universc:$version tomkellygenetics/universc:latest
		podman tag universc:$version tomkellygenetics/universc:$version
		podman push tomkellygenetics/universc:latest
		podman push tomkellygenetics/universc:$version
		podman tag universc:$version docker.io/tomkellygenetics/universc:latest
		podman tag universc:$version docker/io/tomkellygenetics/universc:$version
		podman push docker.io/ tomkellygenetics/universc:latest
		podman push docker/io/tomkellygenetics/universc:$version
		podman tag universc:$version docker.pkg.github.com/minoda-lab/universc/universc:$version
		podman tag universc:$version docker.pkg.github.com/minoda-lab/universc/universc:latest
		podman push docker.pkg.github.com/minoda-lab/universc/universc:latest

Admin message